Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Gene Expression, Stable Transfection, shRNA, Construct, Immunofluorescence, Staining, Transfection, Plasmid Preparation, Comparison, Software

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Immunofluorescence, Staining, Expressing, shRNA, Software, Construct, Western Blot, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Construct, Western Blot, Expressing, Staining, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Staining, Expressing, shRNA, Construct, Western Blot, Immunoprecipitation, TRAP Assay, Cell Culture, Control, Labeling, Protein Extraction, Muscles, Injection, Comparison, Software, Electron Microscopy, Plasmid Preparation

Journal: Frontiers in Cell and Developmental Biology

Article Title: Autophagy Drives Galectin-1 Secretion From Tumor-Associated Macrophages Facilitating Hepatocellular Carcinoma Progression

doi: 10.3389/fcell.2021.741820

Figure Lengend Snippet: Gal-1 secretion is mediated by autophagy. (A) BMDMs were pretreated with 3MA (2 mM) or Brefeldin A (30 nM) for 1 h and then treated with MCM for another 24 h. The expression of cytosolic LC3-I/II, β-actin, and supernatant G-1 proteins was determined by Western blotting. All blots were derived from a single experiment. (B) BMDMs were treated with MCM for 12 h and stained with anti-LC3 antibody. The LC3 aggregation (green) was observed by confocal microscopy. Scale bar = 10 μm. (C) RAW 264.7 cells stably expressing luciferase (Luc) or Atg5 shRNA were treated with MCM for 24 h. The expression of cytosolic Atg5, β-actin, and supernatant Gal-1 proteins was determined by Western blotting. All blots were derived from a single experiment. (D) RAW264.7 cells were transfected with control or Stx17 siRNA at 10 μM for 24 h and then treated with MCM for another 24 h. The expression of cytosolic Gal-1, Stx17, p62, β-actin, and supernatant Gal-1 proteins was determined by Western blotting. All blots were derived from a single experiment. (E) BMDMs were treated with MCM for 12 h and stained with anti-Gal-1 (green) and -LC3 (red) antibodies. The distribution of these proteins was analyzed by confocal microscopy. Scale bar = 10 μm. (F) BMDMs were treated with MCM for 6 h to detect Gal-1 by immunoelectron microscopy. Gold nanoparticle-labeled Gal-1 (arrow bead) in the autophagosomes was observed under a transmission electron microscope. Scale bar = 60 nm. (G) RAW 264.7 cells were treated with MCM for 6 h to isolate autophagosomes. The expression of calreticulin, HSP60, LC3-I/II, and Gal-1 proteins in different cell components was determined by Western blotting. WCL: whole cell lysates; PNS: post-nuclear supernatants; AP: autophagosomes. All blots were derived from a single experiment. (H) WT and Atg5-/- MEF cells were transfected with Gal-1-GFP to monitor the Gal-1 trafficking by TIRF microscopy. Selected frames from time-lapse TIRF microscopy with time intervals in seconds are shown. The protein expression of Atg5 of WT and Atg5-/- MEFs was determined by Western blotting (bottom right corner). All blots were derived from a single experiment.

Article Snippet: Antibodies against Gal-1, Stx17, CD63, Rab11, VAMP7, calreticulin, heat shock protein 60 (HSP60), and β-actin were purchased from Abcam (Cambridge, United Kingdom).

Techniques: Expressing, Western Blot, Derivative Assay, Staining, Confocal Microscopy, Stable Transfection, Luciferase, shRNA, Transfection, Control, Immuno-Electron Microscopy, Labeling, Transmission Assay, Microscopy